chr2-74198307-CTTGTGTTGTCCGGCCTTCGGTGAC-TTTCTCTTGTGTTG

Variant names:

• chr2-74198307-CTTGTGTTGTCCGGCCTTCGGTGAC-TTTCTCTTGTGTTG
• rs71391718
• ENST00000624835.2:n.230_254delGTCACCGAAGGCCGGACAACACAAGinsCAACACAAGAGAAA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000624835.2(ENSG00000279070):​n.230_254delGTCACCGAAGGCCGGACAACACAAGinsCAACACAAGAGAAA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: ENSG00000279070 ENST00000624835.2 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.550
• Publications: 1 publications found

Genes affected

ENSG00000279070 (HGNC:):

MTHFD2 (HGNC:7434): (methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase) This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000624835.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENSG00000279070	ENST00000624835.2	TSL:6	n.230_254delGTCACCGAAGGCCGGACAACACAAGinsCAACACAAGAGAAA		non_coding_transcript_exon	Exon 1 of 1
	MTHFD2	ENST00000677997.1		c.24-7398_24-7374delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG		intron	N/A	ENSP00000503074.1
	MTHFD2	ENST00000677170.1		c.-303-3075_-303-3051delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG		intron	N/A	ENSP00000503486.1

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.55

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71391718; hg19: chr2-74425434;