chr20-63408413-CTGCTTCTCCACCTTCCCGAGCCGTCCCATCA-C
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_172107.4(KCNQ2):c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA(p.Met619ArgfsTer13) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).
Frequency
Consequence
NM_172107.4 frameshift, splice_region
Scores
Clinical Significance
Conservation
Publications
- complex neurodevelopmental disorderInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- developmental and epileptic encephalopathy, 7Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- neonatal encephalopathy with non-epileptic myoclonusInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- neonatal-onset developmental and epileptic encephalopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- seizures, benign familial neonatal, 1Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
- seizures, benign familial neonatal, 2Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- benign familial infantile epilepsyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- benign familial neonatal-infantile seizuresInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- benign neonatal seizuresInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant migrating partial seizures of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_172107.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNQ2 | NM_172107.4 | MANE Select | c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA | p.Met619ArgfsTer13 | frameshift splice_region | Exon 16 of 17 | NP_742105.1 | ||
| KCNQ2 | NM_001382235.1 | c.1910_1940delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA | p.Met637ArgfsTer13 | frameshift splice_region | Exon 16 of 17 | NP_001369164.1 | |||
| KCNQ2 | NM_172106.3 | c.1802_1832delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA | p.Met601ArgfsTer13 | frameshift splice_region | Exon 15 of 16 | NP_742104.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNQ2 | ENST00000359125.7 | TSL:1 MANE Select | c.1856_1886delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA | p.Met619ArgfsTer13 | frameshift splice_region | Exon 16 of 17 | ENSP00000352035.2 | ||
| KCNQ2 | ENST00000626839.2 | TSL:1 | c.1802_1832delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA | p.Met601ArgfsTer13 | frameshift splice_region | Exon 15 of 16 | ENSP00000486706.1 | ||
| KCNQ2 | ENST00000344462.8 | TSL:1 | c.1763_1793delTGATGGGACGGCTCGGGAAGGTGGAGAAGCA | p.Met588ArgfsTer13 | frameshift splice_region | Exon 15 of 16 | ENSP00000339611.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at