chr21-34792391-A-AACGGGCCTCCCTGCGCTTGCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001754.5(RUNX1):c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT(p.Ser389_Pro395dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★★).
Frequency
Consequence
NM_001754.5 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- hereditary thrombocytopenia and hematologic cancer predisposition syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
- acute myeloid leukemiaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001754.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RUNX1 | NM_001754.5 | MANE Select | c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT | p.Ser389_Pro395dup | conservative_inframe_insertion | Exon 9 of 9 | NP_001745.2 | ||
| RUNX1 | NM_001001890.3 | c.1085_1105dupCGCAAGCGCAGGGAGGCCCGT | p.Ser362_Pro368dup | conservative_inframe_insertion | Exon 6 of 6 | NP_001001890.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RUNX1 | ENST00000675419.1 | MANE Select | c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT | p.Ser389_Pro395dup | conservative_inframe_insertion | Exon 9 of 9 | ENSP00000501943.1 | ||
| RUNX1 | ENST00000300305.7 | TSL:1 | c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT | p.Ser389_Pro395dup | conservative_inframe_insertion | Exon 8 of 8 | ENSP00000300305.3 | ||
| RUNX1 | ENST00000344691.8 | TSL:1 | c.1085_1105dupCGCAAGCGCAGGGAGGCCCGT | p.Ser362_Pro368dup | conservative_inframe_insertion | Exon 6 of 6 | ENSP00000340690.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000212 AC: 3AN: 1413792Hom.: 0 Cov.: 35 AF XY: 0.00000143 AC XY: 1AN XY: 698852 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Inborn genetic diseases Uncertain:1
The c.1166_1186dup21 variant (also known as p.S389_P395dup), located in coding exon 8 of the RUNX1 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 1166 to 1186. This results in the duplication of 7 extra residues (SQAQGGP) between codons 389 and 395. This amino acid region is well conserved in available vertebrate species. In addition, this variant is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear.
not provided Uncertain:1
Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 7 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge
Hereditary thrombocytopenia and hematologic cancer predisposition syndrome Uncertain:1
NM_001754.5(RUNX1):c.1166_1186dup (p.Pro395_Phe396insSerGlnAlaGlnGlyGlyPro) is an in-frame duplication variant which is predicted to cause a change in the length of the protein by duplicating 7 amino acids (p.S389_P395dup) in a nonrepeat region but not the runt homology domain (PM4 is not met). The splice site predictor SpliceAI indicated that the variant has no impact on splicing. This variant is absent from gnomAD v2 and v3 (PM2_supporting) and has not been reported in the literature. In summary, this variant meets the criteria to be classified as a variant of uncertain significance for autosomal dominant hereditary thrombocytopenia and hematologic cancer predisposition syndrome based on the ACMG/AMP criteria applied, as specified by the ClinGen Myeloid Malignancy VCEP: PM2_supporting.
Hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1 Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 409806). This variant has not been reported in the literature in individuals affected with RUNX1-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.1166_1186dup, results in the insertion of 7 amino acid(s) of the RUNX1 protein (p.Ser389_Pro395dup), but otherwise preserves the integrity of the reading frame.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at