chr22-37983510-A-ACGGGCATGGGCACCAGCGTC
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_006941.4(SOX10):c.255_274dupGACGCTGGTGCCCATGCCCG(p.Val92GlyfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_006941.4 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SOX10 | NM_006941.4 | c.255_274dupGACGCTGGTGCCCATGCCCG | p.Val92GlyfsTer24 | frameshift_variant | Exon 2 of 4 | ENST00000396884.8 | NP_008872.1 | |
| POLR2F | NM_001301130.2 | c.294-2642_294-2623dupGGGCATGGGCACCAGCGTCC | intron_variant | Intron 4 of 5 | NP_001288059.1 | |||
| POLR2F | NM_001363825.1 | c.*38+11202_*38+11221dupGGGCATGGGCACCAGCGTCC | intron_variant | Intron 5 of 5 | NP_001350754.1 | |||
| POLR2F | NM_001301131.2 | c.293+16342_293+16361dupGGGCATGGGCACCAGCGTCC | intron_variant | Intron 4 of 4 | NP_001288060.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Waardenburg syndrome type 4C Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at