chr22-37983510-A-ACGGGCATGGGCACCAGCGTC

Variant names:

• chr22-37983510-A-ACGGGCATGGGCACCAGCGTC
• rs1555939476
• NM_006941.4:c.255_274dupGACGCTGGTGCCCATGCCCG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_006941.4(SOX10):​c.255_274dupGACGCTGGTGCCCATGCCCG​(p.Val92GlyfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SOX10 NM_006941.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.50
• Publications: 0 publications found

Genes affected

SOX10 (HGNC:11190): (SRY-box transcription factor 10) This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease. [provided by RefSeq, Jul 2008]

POLR2F (HGNC:9193): (RNA polymerase II, I and III subunit F) This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 22-37983510-A-ACGGGCATGGGCACCAGCGTC is Pathogenic according to our data. Variant chr22-37983510-A-ACGGGCATGGGCACCAGCGTC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 547775.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006941.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SOX10	NM_006941.4	MANE Select	c.255_274dupGACGCTGGTGCCCATGCCCG	p.Val92GlyfsTer24	frameshift	Exon 2 of 4	NP_008872.1
	POLR2F	NM_001301130.2		c.294-2642_294-2623dupGGGCATGGGCACCAGCGTCC		intron	N/A	NP_001288059.1
	POLR2F	NM_001363825.1		c.*38+11202_*38+11221dupGGGCATGGGCACCAGCGTCC		intron	N/A	NP_001350754.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SOX10	ENST00000396884.8	TSL:1 MANE Select	c.255_274dupGACGCTGGTGCCCATGCCCG	p.Val92GlyfsTer24	frameshift	Exon 2 of 4	ENSP00000380093.2
	SOX10	ENST00000360880.6	TSL:1	c.255_274dupGACGCTGGTGCCCATGCCCG	p.Val92GlyfsTer24	frameshift	Exon 3 of 5	ENSP00000354130.2
	SOX10	ENST00000698177.1		c.471_490dupGACGCTGGTGCCCATGCCCG	p.Val164GlyfsTer24	frameshift	Exon 3 of 5	ENSP00000513596.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Waardenburg syndrome type 4C Pathogenic:1

Nov 01, 2016

Center for Human Genetics, Inc, Center for Human Genetics, Inc

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555939476; hg19: chr22-38379517;