chr3-123700336-G-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_053025.4(MYLK):c.3096_3131dupTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC(p.Ala1044_Glu1045insGluThrLeuLysProMetGlyAsnAlaLysProAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A1044A) has been classified as Likely benign.
Frequency
Consequence
NM_053025.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000137 AC: 2AN: 1461830Hom.: 0 Cov.: 40 AF XY: 0.00 AC XY: 0AN XY: 727208 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 30
ClinVar
Submissions by phenotype
Aortic aneurysm, familial thoracic 7 Uncertain:1
This variant, c.3096_3131dup36, results in the insertion of 12 amino acid(s) of the MYLK protein (p.Ala1044_Pro1055dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYLK-related conditions. ClinVar contains an entry for this variant (Variation ID: 658577). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not specified Uncertain:1
Variant summary: MYLK c.3096_3131dup36 (p.Ala1044_Pro1055dup) results in an in-frame duplication that is predicted to duplicate 12 amino acids into the encoded protein. The variant was absent in 251462 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.3096_3131dup36 in individuals affected with Aortopathy and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 658577). Based on the evidence outlined above, the variant was classified as uncertain significance. -
Familial thoracic aortic aneurysm and aortic dissection Uncertain:1
The c.3096_3131dup36 variant (also known as p.P1055_D1056ins12), located in coding exon 15 of the MYLK gene, results from an in-frame duplication of 36 nucleotides at nucleotide positions 3096 to 3131. This results in the duplication of 12 extra residues (ETLKPMGNAKPA) between codons 1055 and 1056. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
not provided Uncertain:1
In-frame duplication of 12 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at