chr3-123700336-G-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA

Variant names:

• chr3-123700336-G-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA
• rs758966808
• NM_053025.4:c.3096_3131dupTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_053025.4(MYLK):​c.3096_3131dupTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC​(p.Ala1044_Glu1045insGluThrLeuLysProMetGlyAsnAlaLysProAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A1044A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 0.0000014 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MYLK NM_053025.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 0.734
• Publications: 1 publications found

Genes affected

MYLK (HGNC:7590): (myosin light chain kinase) This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]

MYLK-AS1 (HGNC:42440): (MYLK antisense RNA 1)

LOC105369194 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_053025.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYLK	NM_053025.4	c.3096_3131dupTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Ala1044_Glu1045insGluThrLeuLysProMetGlyAsnAlaLysProAla	disruptive_inframe_insertion	Exon 18 of 34	ENST00000360304.8	NP_444253.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYLK	ENST00000360304.8	c.3096_3131dupTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Ala1044_Glu1045insGluThrLeuLysProMetGlyAsnAlaLysProAla	disruptive_inframe_insertion	Exon 18 of 34	5	NM_053025.4	ENSP00000353452.3

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000137 AC: 2 AN: 1461830 Hom.: 0 Cov.: 40 AF XY: 0.00 AC XY: 0 AN XY: 727208

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33476

American (AMR) AF: 0.00 AC: 0 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111976

Other (OTH) AF: 0.00 AC: 0 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Aortic aneurysm, familial thoracic 7 Uncertain:1

Jul 05, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.3096_3131dup36, results in the insertion of 12 amino acid(s) of the MYLK protein (p.Ala1044_Pro1055dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYLK-related conditions. ClinVar contains an entry for this variant (Variation ID: 658577). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not specified Uncertain:1

Jul 15, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: MYLK c.3096_3131dup36 (p.Ala1044_Pro1055dup) results in an in-frame duplication that is predicted to duplicate 12 amino acids into the encoded protein. The variant was absent in 251462 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.3096_3131dup36 in individuals affected with Aortopathy and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 658577). Based on the evidence outlined above, the variant was classified as uncertain significance. -

Familial thoracic aortic aneurysm and aortic dissection Uncertain:1

Dec 15, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3096_3131dup36 variant (also known as p.P1055_D1056ins12), located in coding exon 15 of the MYLK gene, results from an in-frame duplication of 36 nucleotides at nucleotide positions 3096 to 3131. This results in the duplication of 12 extra residues (ETLKPMGNAKPA) between codons 1055 and 1056. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

not provided Uncertain:1

May 16, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame duplication of 12 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.73
Mutation Taster		=83/17	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs758966808; hg19: chr3-123419183;