chr3-181712336-GGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCC-G
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_StrongPM2PP5
The NM_003106.4(SOX2):c.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Genomes: not found (cov: 32)
Consequence
SOX2
NM_003106.4 frameshift, start_lost
NM_003106.4 frameshift, start_lost
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 3.26
Genes affected
SOX2 (HGNC:11195): (SRY-box transcription factor 2) This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]
SOX2-OT (HGNC:20209): (SOX2 overlapping transcript) This gene produces alternatively spliced long non-coding RNAs. These RNAs were observed to be upregulated in tumor cells and positively correlated to expression of the SRY-box 2 gene. Overexpression of these transcripts may promote cell proliferation. [provided by RefSeq, Dec 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-181712336-GGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCC-G is Pathogenic according to our data. Variant chr3-181712336-GGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 986769.Status of the report is no_assertion_criteria_provided, 0 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SOX2 | NM_003106.4 | c.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC | p.Met1fs | frameshift_variant, start_lost | 1/1 | ENST00000325404.3 | NP_003097.1 | |
SOX2 | NM_003106.4 | c.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC | 5_prime_UTR_variant | 1/1 | ENST00000325404.3 | NP_003097.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SOX2 | ENST00000325404.3 | c.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC | p.Met1fs | frameshift_variant, start_lost | 1/1 | 6 | NM_003106.4 | ENSP00000323588.1 | ||
SOX2 | ENST00000325404 | c.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC | 5_prime_UTR_variant | 1/1 | NM_003106.4 | ENSP00000323588.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link
Submissions by phenotype
Anophthalmia/microphthalmia-esophageal atresia syndrome Pathogenic:1
Pathogenic, no assertion criteria provided | clinical testing | Anophthalmia/Microphthalmia Research Registry, Einstein Medical Center Philadelphia | - | Patient has symptoms similar to SOX2 related disease and is suspected to be pathogenic - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at