chr3-25598292-GTGCTCTTTGGGCACTTAATTAAACATTGCAA-TTGCAATGTTTAATTAAGTGCCCAAAGAGCAC

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2PP3

The NM_001330700.2(TOP2B):​c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA​(p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln) variant causes a stop retained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

TOP2B
NM_001330700.2 stop_retained

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 8.04
Variant links:
Genes affected
TOP2B (HGNC:11990): (DNA topoisomerase II beta) This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 3 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TOP2BNM_001330700.2 linkc.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln stop_retained_variant ENST00000264331.9 NP_001317629.1 Q02880-1
TOP2BNM_001330700.2 linkc.4869_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA 3_prime_UTR_variant Exon 36 of 36 ENST00000264331.9 NP_001317629.1 Q02880-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TOP2BENST00000264331.9 linkc.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln stop_retained_variant 5 NM_001330700.2 ENSP00000264331.4 Q02880-1
TOP2BENST00000264331 linkc.4869_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA 3_prime_UTR_variant Exon 36 of 36 5 NM_001330700.2 ENSP00000264331.4 Q02880-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Dec 14, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (Non-coding) in the TOP2B gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 5 amino acid(s) of the TOP2B protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TOP2B-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-25639783; API