chr3-37020387-G-GCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT

Position:

• chr3-37020387-G-GCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000249.4(MLH1):​c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT​(p.Ser339fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,214 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
• Consequence: MLH1 NM_000249.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 0.504

Genes affected

MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]

MLH1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-37020387-G-GCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT is Pathogenic according to our data. Variant chr3-37020387-G-GCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT is described in ClinVar as [Pathogenic]. Clinvar id is 433861.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MLH1	NM_000249.4	c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT	p.Ser339fs	frameshift_variant	11/19	ENST00000231790.8	NP_000240.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MLH1	ENST00000231790.8	c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT	p.Ser339fs	frameshift_variant	11/19	1	NM_000249.4	ENSP00000231790.3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152214 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000478

GnomAD4 exome Cov.: 31

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152214 Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1 AN XY: 74370

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.000478

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine	Oct 15, 2018	The c.963_1014dup (p.Ser339Hisfs*40) variant in the MLH1 gene is predicted to introduce a premature translation termination codon. This variant has never been reported in general population databases. Therefore, this c.963_1014dup (p.Ser339Hisfs*40) variant is classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Myriad Genetics, Inc.	Jul 19, 2023	This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Lynch syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Department of Pathology and Laboratory Medicine, Sinai Health System

Mar 23, 2016

- -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 07, 2019

Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals with MLH1-related conditions. ClinVar contains an entry for this variant (Variation ID: 433861). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser339Hisfs*40) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553648058; hg19: chr3-37061878;