chr3-37050540-G-GTCTATAAAGCCTTGCGCTCACACATTCTGCC
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_StrongPM2PP5_Very_Strong
The NM_000249.4(MLH1):c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC(p.Pro731fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Genomes: not found (cov: 32)
Consequence
MLH1
NM_000249.4 frameshift, stop_gained
NM_000249.4 frameshift, stop_gained
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 7.83
Genes affected
MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 14 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 9 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-37050540-G-GTCTATAAAGCCTTGCGCTCACACATTCTGCC is Pathogenic according to our data. Variant chr3-37050540-G-GTCTATAAAGCCTTGCGCTCACACATTCTGCC is described in ClinVar as [Pathogenic]. Clinvar id is 455421.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MLH1 | NM_000249.4 | c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro731fs | frameshift_variant, stop_gained | 19/19 | ENST00000231790.8 | NP_000240.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MLH1 | ENST00000231790.8 | c.2161_2191dupTATAAAGCCTTGCGCTCACACATTCTGCCTC | p.Pro731fs | frameshift_variant, stop_gained | 19/19 | 1 | NM_000249.4 | ENSP00000231790.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 31
GnomAD4 exome
Cov.:
31
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Myriad Genetics, Inc. | Jul 25, 2023 | This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. - |
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 04, 2018 | Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). This truncation affects the highly conserved C-terminal domain responsible for MLH1 constitutive dimerization with PMS2 (PMID: 12799449, 16338176, 20533529). Different truncating variants downstream of this variant (including p.Lys732* and p.Tyr750*) have been reported in individuals affected with Lynch syndrome and have been determined to be pathogenic (PMID: 10923051, 25197397, 10422993, Invitae). This suggests that disruption of this region of the MLH1 protein is causative of disease. For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals with MLH1-related disease. ClinVar contains an entry for this variant (Variation ID: 455421). This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MLH1 gene (p.Pro731Leufs*2). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 26 amino acids of the MLH1 protein. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at