chr4-41745990-TGCCGCCGCCGCCGCTGCCGCGGCC-T
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_003924.4(PHOX2B):c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC(p.Ala247_Ala254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000147 in 1,089,222 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A246A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PHOX2B | ENST00000226382.4 | c.738_761delGGCCGCGGCAGCGGCGGCGGCGGC | p.Ala247_Ala254del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_003924.4 | ENSP00000226382.2 | ||
PHOX2B | ENST00000510424.2 | n.*19_*42delGGCCGCGGCAGCGGCGGCGGCGGC | downstream_gene_variant | 3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.0000147 AC: 16AN: 1089222Hom.: 1 AF XY: 0.0000153 AC XY: 8AN XY: 522656 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at