chr5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000038.6(APC):c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT(p.Phe510fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 33)
Consequence
APC
NM_000038.6 frameshift, splice_donor, splice_region, intron
NM_000038.6 frameshift, splice_donor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 10.0
Genes affected
APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C is Pathogenic according to our data. Variant chr5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 469710.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
APC | ENST00000257430.9 | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 12/16 | 5 | NM_000038.6 | ENSP00000257430.4 | ||
ENSG00000258864 | ENST00000520401.1 | n.12_33+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant | 1/8 | 3 | ENSP00000454861.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Familial adenomatous polyposis 1 Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 13, 2017 | This sequence change affects donor splice site in intron 12 of the APC gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with a APC-related disease. In summary, donor and acceptor splice site variants are typically truncating (PMID: 16199547), and truncating variants in APC are known to be pathogenic (PMID: 20685668, 17963004). However, without additional functional and/or genetic data, this variant has been classified as Likely Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at