chr5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000038.6(APC):​c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT​(p.Phe510fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

APC
NM_000038.6 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C is Pathogenic according to our data. Variant chr5-112827225-CTTTTGGAGATGTAGCCAACAAGGTATGTT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 469710.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
APCNM_000038.6 linkc.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT p.Phe510fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 12/16 ENST00000257430.9 NP_000029.2 P25054-1Q4LE70

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
APCENST00000257430.9 linkc.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT p.Phe510fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 12/165 NM_000038.6 ENSP00000257430.4 P25054-1
ENSG00000258864ENST00000520401.1 linkn.12_33+7delTTTTGGAGATGTAGCCAACAAGGTATGTT splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant 1/83 ENSP00000454861.1 H3BNH8

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial adenomatous polyposis 1 Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJan 13, 2017This sequence change affects donor splice site in intron 12 of the APC gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with a APC-related disease. In summary, donor and acceptor splice site variants are typically truncating (PMID: 16199547), and truncating variants in APC are known to be pathogenic (PMID: 20685668, 17963004). However, without additional functional and/or genetic data, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554081752; hg19: chr5-112162922; API