chr5-112840567-G-GTGATCTAACAATCGAATCCCCTCCAAA
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000038.6(APC):c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA(p.Asp1659_Asn1667dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000038.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
APC | ENST00000257430.9 | c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA | p.Asp1659_Asn1667dup | disruptive_inframe_insertion | Exon 16 of 16 | 5 | NM_000038.6 | ENSP00000257430.4 | ||
ENSG00000258864 | ENST00000520401.1 | n.228+11599_228+11625dupTCTAACAATCGAATCCCCTCCAAATGA | intron_variant | Intron 3 of 7 | 3 | ENSP00000454861.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 65
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial adenomatous polyposis 1 Uncertain:1
This variant, c.4977_5003dup, results in the insertion of 9 amino acid(s) of the APC protein (p.Asp1659_Asn1667dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with APC-related conditions. ClinVar contains an entry for this variant (Variation ID: 419228). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
This insertion of 27 nucleotides in APC is denoted c.4977_5003dup27 at the cDNA level and p.D1659_N1667dup at the protein level. The normal sequence, with the bases that are inserted in braces, is GTGA[dup27]GTTA. This in frame insertion occurs in a region which is conserved through mammals and is located within SAMP repeats/axin binding domain (Azzopardi 2008). This variant has not, to our knowledge, been published in the literature as pathogenic or benign. Since in frame duplications may or may not inhibit proper protein functioning, the clinical significance of this finding remains unclear at this time and we consider APC D1659_N1667dup to be a variant of uncertain significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.4977_5003dup27 variant (also known as p.D1659_N1667dup), located in coding exon 15 of the APC gene, results from an in-frame duplication of 27 nucleotides at nucleotide positions 4977 to 5003. This results in the duplication of 9 extra residues (DLTIESPPN) between codons 1659 and 1667. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at