chr5-132369881-TGCCTGGTCGGCGGCGGGTGCCCCGCGCGCACGCGCAAAGCCCGCCGCGTTCCCCGACCCCAGGCCGCGCTCTGTGGGCCTCTGAGGGCGGCATGCGGGACTACGACGAGGTGA-T
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate
The NM_003060.4(SLC22A5):c.-91_22del(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_003060.4 frameshift, start_lost
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 14 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SLC22A5 | ENST00000245407.8 | c.-91_22del | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 10 | 1 | NM_003060.4 | ENSP00000245407.3 | ||
SLC22A5 | ENST00000245407 | c.-91_22del | 5_prime_UTR_variant | Exon 1 of 10 | 1 | NM_003060.4 | ENSP00000245407.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Renal carnitine transport defect Pathogenic:2
Variant summary: SLC22A5 c.-91_22del113 deletes the initiation codon and is predicted to result either in absence of the protein or truncation of the encoded protein due to translation initiation at a downstream codon. The frequency of this variant in the general population could not be determined as the technology used for large population databases (ExAC, gnomAD, ESP, 1000G) cannot detect variants of this type. The variant, c.-91_22del113, has been reported in the literature in two homozygous siblings affected with Systemic Primary Carnitine Deficiency, indicating that the variant may be associated with disease (Nezu_1999). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014, though a submission prior to 2014 was reported as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at