chr5-132680583-AGAAGCAAGATGGCCTGTTGGGAGGCTACCACAGTAAACCAGGCTAGAGATGATGGTGGCGTGGACAGAATGAAGCAAGATGGCCTGTTGGGAGGCTACCACAGTAAACCAGGCTAGAGACGATGGTGGCGTGGACAGAAT-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000589.4(IL4):​c.360+765_360+904del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: not found (cov: 32)

Consequence

IL4
NM_000589.4 intron

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 1.02
Variant links:
Genes affected
IL4 (HGNC:6014): (interleukin 4) The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
IL4NM_000589.4 linkc.360+765_360+904del intron_variant Intron 3 of 3 ENST00000231449.7 NP_000580.1 P05112-1D4HNR6
IL4NM_172348.3 linkc.312+765_312+904del intron_variant Intron 2 of 2 NP_758858.1 P05112-2Q5FC01
IL4NM_001354990.2 linkc.*50+765_*50+904del intron_variant Intron 4 of 4 NP_001341919.1
LOC105379176NR_134248.1 linkn.177-607_177-468del intron_variant Intron 1 of 1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
IL4ENST00000231449.7 linkc.360+694_360+833del intron_variant Intron 3 of 3 1 NM_000589.4 ENSP00000231449.2 P05112-1
IL4ENST00000350025.2 linkc.312+694_312+833del intron_variant Intron 2 of 2 1 ENSP00000325190.3 P05112-2
IL4ENST00000622422.1 linkc.*50+694_*50+833del intron_variant Intron 4 of 4 1 ENSP00000480581.1 U3LVN1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs8179190; hg19: chr5-132016275; API