chr5-140114148-AGGCGGCGGCGGCGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCGAGCAGGGTGGTGCGGCGCTGGGTTCGGGCGGCTCCCTGGGGCACCCCGGCTCGGGCTCAGGCTCCGGCGGGGGCGGTGGTGGCGGCGGGGGCGGCGGCGGCAGT-A
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_005859.5(PURA):c.-20_142del(p.Met1_Gly48del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_005859.5 start_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PURA | NM_005859.5 | c.-20_142del | p.Met1_Gly48del | start_lost, conservative_inframe_deletion | Exon 1 of 1 | ENST00000331327.5 | NP_005850.1 | |
PURA | NM_005859.5 | c.-20_142del | 5_prime_UTR_variant | Exon 1 of 1 | ENST00000331327.5 | NP_005850.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PURA | ENST00000331327.5 | c.-20_142del | p.Met1_Gly48del | start_lost, conservative_inframe_deletion | Exon 1 of 1 | 6 | NM_005859.5 | ENSP00000332706.3 | ||
PURA | ENST00000331327 | c.-20_142del | 5_prime_UTR_variant | Exon 1 of 1 | NM_005859.5 | ENSP00000332706.3 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Inborn genetic diseases Pathogenic:1
The c.-20_142del162 (p.M1?) alteration is located in coding exon 1 of the PURA gene and results from a deletion of 162 nucleotides at position -20 to 142. This deletion likely includes the initiation codon. Sequence variations that modify the initiation codon are expected to result in either loss of translation initiation, N-terminal truncation, or cause a shift in the mRNA reading frame. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). This region is not highly conserved in available vertebrate species with limited sequence alignment. Based on the available evidence, this alteration is classified as pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.