chr5-70946064-AGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATAT-A
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP3PP5
The NM_000344.4(SMN1):c.724_834del variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_000344.4 exon_loss, splice_region
Scores
Clinical Significance
Conservation
Publications
- spinal muscular atrophyInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- spinal muscular atrophy, type 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Genomics England PanelApp
- spinal muscular atrophy, type IIInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- spinal muscular atrophy, type IIIInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- spinal muscular atrophy, type IVInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SMN1 | NM_000344.4 | c.724_834del | exon_loss_variant, splice_region_variant | Exon 7 of 9 | ENST00000380707.9 | NP_000335.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| SMN1 | ENST00000380707.9 | c.724-1_833del | p.Ile242fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 7 of 9 | 1 | NM_000344.4 | ENSP00000370083.4 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 genome Cov.: 0
ClinVar
Submissions by phenotype
Kugelberg-Welander disease;C0393538:Spinal muscular atrophy, type II;C1838230:Spinal muscular atrophy, type IV;C5848259:Werdnig-Hoffmann disease Pathogenic:1
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at