chr6-129315539-ACCAAGGGCATTGTTTTTCAACAT-A
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000426.4(LAMA2):c.3623_3645delAGGGCATTGTTTTTCAACATCCA(p.Lys1208ArgfsTer27) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000124 in 1,614,104 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000426.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
LAMA2 | NM_000426.4 | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift_variant | Exon 25 of 65 | ENST00000421865.3 | NP_000417.3 | |
LAMA2 | NM_001079823.2 | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift_variant | Exon 25 of 64 | NP_001073291.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
LAMA2 | ENST00000421865.3 | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift_variant | Exon 25 of 65 | 5 | NM_000426.4 | ENSP00000400365.2 | ||
LAMA2 | ENST00000618192.5 | c.3887_3909delAGGGCATTGTTTTTCAACATCCA | p.Lys1296ArgfsTer27 | frameshift_variant | Exon 26 of 66 | 5 | ENSP00000480802.2 | |||
LAMA2 | ENST00000617695.5 | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift_variant | Exon 25 of 64 | 5 | ENSP00000481744.2 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.00000398 AC: 1AN: 251470Hom.: 0 AF XY: 0.00000736 AC XY: 1AN XY: 135904
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461882Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727246
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74376
ClinVar
Submissions by phenotype
Merosin deficient congenital muscular dystrophy Pathogenic:2
- -
- -
not provided Pathogenic:2
Reported previously with a second variant (phase unknown) in an individual with congenital hydrocephalus; reported using alternate nomenclature p.T1207fs (PMID: 33077954); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 9674786, 30055037, 33077954) -
- -
LAMA2-related muscular dystrophy Pathogenic:1
This sequence change creates a premature translational stop signal (p.Lys1208Argfs*27) in the LAMA2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in LAMA2 are known to be pathogenic (PMID: 18700894, 32904964). This variant is present in population databases (rs763713872, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with LAMA2-related conditions. ClinVar contains an entry for this variant (Variation ID: 167242). For these reasons, this variant has been classified as Pathogenic. -
Merosin deficient congenital muscular dystrophy;C4748327:Muscular dystrophy, limb-girdle, autosomal recessive 23 Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at