chr6-129315539-ACCAAGGGCATTGTTTTTCAACAT-A
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000426.4(LAMA2):c.3623_3645delAGGGCATTGTTTTTCAACATCCA(p.Lys1208ArgfsTer27) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000124 in 1,614,104 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000426.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- congenital merosin-deficient muscular dystrophy 1AInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P, Myriad Women’s Health
- LAMA2-related muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- muscular dystrophy, limb-girdle, autosomal recessive 23Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000426.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LAMA2 | MANE Select | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift | Exon 25 of 65 | NP_000417.3 | |||
| LAMA2 | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift | Exon 25 of 64 | NP_001073291.2 | A0A087WYF1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LAMA2 | TSL:5 MANE Select | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift | Exon 25 of 65 | ENSP00000400365.2 | P24043 | ||
| LAMA2 | TSL:5 | c.3887_3909delAGGGCATTGTTTTTCAACATCCA | p.Lys1296ArgfsTer27 | frameshift | Exon 26 of 66 | ENSP00000480802.2 | A0A087WX80 | ||
| LAMA2 | TSL:5 | c.3623_3645delAGGGCATTGTTTTTCAACATCCA | p.Lys1208ArgfsTer27 | frameshift | Exon 25 of 64 | ENSP00000481744.2 | A0A087WYF1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251470 AF XY: 0.00000736 show subpopulations
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461882Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727246 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74376 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at