chr6-129464288-AGTCCTCAGGTGGAAGATAGTGAGGGGACTATTCAATTTGATGGAGAAGGTTATGCATTGGTCAGCCGTCCCATTCGCTGGTACCCCAACATCTCCACTGTCATGTTCAAGTTCAGAACATTTTCTTCGAGTGCTCTTCTGATGTATCTTGCCACACGAGACCT-A
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3PP5_Moderate
The NM_000426.4(LAMA2):c.6993_7155del variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_000426.4 exon_loss, splice_region
Scores
Clinical Significance
Conservation
Publications
- congenital merosin-deficient muscular dystrophy 1AInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P
- LAMA2-related muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- muscular dystrophy, limb-girdle, autosomal recessive 23Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000426.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LAMA2 | NM_000426.4 | MANE Select | c.6993_7155del | exon_loss splice_region | Exon 50 of 65 | NP_000417.3 | |||
| LAMA2 | NM_001079823.2 | c.6993_7155del | exon_loss splice_region | Exon 50 of 64 | NP_001073291.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LAMA2 | ENST00000421865.3 | TSL:5 MANE Select | c.6993-1_7154del | p.Ser2331_Leu2385delinsArg | splice_acceptor disruptive_inframe_deletion splice_region intron | Exon 50 of 65 | ENSP00000400365.2 | ||
| LAMA2 | ENST00000618192.5 | TSL:5 | c.7257-1_7418del | p.Ser2419_Leu2473delinsArg | splice_acceptor disruptive_inframe_deletion splice_region intron | Exon 51 of 66 | ENSP00000480802.2 | ||
| LAMA2 | ENST00000617695.5 | TSL:5 | c.6993-1_7154del | p.Ser2331_Leu2385delinsArg | splice_acceptor disruptive_inframe_deletion splice_region intron | Exon 50 of 64 | ENSP00000481744.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at