chr6-156778268-CCAGCAGCAGCAGCAGCAGCAG-C
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BP3BP6_ModerateBS2_Supporting
The NM_001374828.1(ARID1B):c.591_611delGCAGCAGCAGCAGCAGCAGCA(p.Gln198_Gln204del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000228 in 1,536,826 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_001374828.1 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina, ClinGen
- Coffin-Siris syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001374828.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARID1B | NM_001374828.1 | MANE Select | c.591_611delGCAGCAGCAGCAGCAGCAGCA | p.Gln198_Gln204del | disruptive_inframe_deletion | Exon 1 of 20 | NP_001361757.1 | ||
| ARID1B | NM_001438482.1 | c.591_611delGCAGCAGCAGCAGCAGCAGCA | p.Gln198_Gln204del | disruptive_inframe_deletion | Exon 1 of 21 | NP_001425411.1 | |||
| ARID1B | NM_001438483.1 | c.591_611delGCAGCAGCAGCAGCAGCAGCA | p.Gln198_Gln204del | disruptive_inframe_deletion | Exon 1 of 21 | NP_001425412.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARID1B | ENST00000636930.2 | TSL:2 MANE Select | c.591_611delGCAGCAGCAGCAGCAGCAGCA | p.Gln198_Gln204del | disruptive_inframe_deletion | Exon 1 of 20 | ENSP00000490491.2 | ||
| ARID1B | ENST00000346085.10 | TSL:1 | c.591_611delGCAGCAGCAGCAGCAGCAGCA | p.Gln198_Gln204del | disruptive_inframe_deletion | Exon 2 of 21 | ENSP00000344546.5 | ||
| ARID1B | ENST00000350026.11 | TSL:1 | c.591_611delGCAGCAGCAGCAGCAGCAGCA | p.Gln198_Gln204del | disruptive_inframe_deletion | Exon 1 of 19 | ENSP00000055163.8 |
Frequencies
GnomAD3 genomes AF: 0.0000529 AC: 8AN: 151256Hom.: 0 Cov.: 30 show subpopulations
GnomAD4 exome AF: 0.0000195 AC: 27AN: 1385456Hom.: 0 AF XY: 0.0000219 AC XY: 15AN XY: 683558 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000529 AC: 8AN: 151370Hom.: 0 Cov.: 30 AF XY: 0.0000811 AC XY: 6AN XY: 73994 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at