chr7-150950248-CCAGCATGCACCAGTGTGTCCCCTGGCGGTGCATGTGTGGTCTTGAACTTCATGGCCAGGGCCCGAAGGCAGCCCTTGGTGGCCCCTCGGAAGGGTTTGCAGTGCTGCAGCAGTGAGCGGTTCAGGTGCAGGCAGATGT-C
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM2PM4PP3PP5_Moderate
The NM_000238.4(KCNH2):c.2180_2317del(p.Asp727_Ala772del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000238.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
KCNH2 | NM_000238.4 | c.2180_2317del | p.Asp727_Ala772del | disruptive_inframe_deletion | Exon 9 of 15 | ENST00000262186.10 | NP_000229.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 genome Cov.: 30
ClinVar
Submissions by phenotype
Long QT syndrome Pathogenic:1
This variant, c.2180_2317del, results in the deletion of 46 amino acid(s) of the KCNH2 protein (p.Asp727_Ala772del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KCNH2-related conditions. ClinVar contains an entry for this variant (Variation ID: 456903). This variant disrupts a region of the KCNH2 protein in which other variant(s) (p.Asp774Tyr) have been determined to be pathogenic (PMID: 10973849, 11009462, 18441445). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at