chr7-155803238-G-GGGCCGTGAGCGGCGCGTAGGC
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_000193.4(SHH):c.1030_1050dupGCCTACGCGCCGCTCACGGCC(p.Ala350_Gln351insAlaTyrAlaProLeuThrAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000193.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- holoprosencephaly 3Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- microphthalmia, isolated, with coloboma 5Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, PanelApp Australia
- polydactyly of a triphalangeal thumbInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- solitary median maxillary central incisor syndromeInheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: G2P, Ambry Genetics
- skeletal system disorderInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- autosomal dominant preaxial polydactyly-upperback hypertrichosis syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hypoplastic tibiae-postaxial polydactyly syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- microphthalmia, isolated, with colobomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- syndactyly type 4Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- triphalangeal thumb-polysyndactyly syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- holoprosencephalyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000193.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SHH | NM_000193.4 | MANE Select | c.1030_1050dupGCCTACGCGCCGCTCACGGCC | p.Ala350_Gln351insAlaTyrAlaProLeuThrAla | conservative_inframe_insertion | Exon 3 of 3 | NP_000184.1 | ||
| SHH | NM_001310462.2 | c.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC | intron | N/A | NP_001297391.1 | ||||
| SHH | NR_132318.2 | n.563-2592_563-2572dupGCCTACGCGCCGCTCACGGCC | intron | N/A |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SHH | ENST00000297261.7 | TSL:1 MANE Select | c.1030_1050dupGCCTACGCGCCGCTCACGGCC | p.Ala350_Gln351insAlaTyrAlaProLeuThrAla | conservative_inframe_insertion | Exon 3 of 3 | ENSP00000297261.2 | ||
| SHH | ENST00000430104.5 | TSL:1 | c.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC | intron | N/A | ENSP00000396621.1 | |||
| SHH | ENST00000435425.1 | TSL:1 | n.302-2662_302-2642dupGCCTACGCGCCGCTCACGGCC | intron | N/A | ENSP00000413871.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 35
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not specified Uncertain:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at