chr7-155803238-G-GGGCCGTGAGCGGCGCGTAGGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000193.4(SHH):c.1030_1050dupGCCTACGCGCCGCTCACGGCC(p.Ala350_Gln351insAlaTyrAlaProLeuThrAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
SHH
NM_000193.4 conservative_inframe_insertion
NM_000193.4 conservative_inframe_insertion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: -0.0740
Genes affected
SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000193.4.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SHH | ENST00000297261.7 | c.1030_1050dupGCCTACGCGCCGCTCACGGCC | p.Ala350_Gln351insAlaTyrAlaProLeuThrAla | conservative_inframe_insertion | Exon 3 of 3 | 1 | NM_000193.4 | ENSP00000297261.2 | ||
SHH | ENST00000430104.5 | c.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC | intron_variant | Intron 3 of 3 | 1 | ENSP00000396621.1 | ||||
SHH | ENST00000435425.1 | n.302-2662_302-2642dupGCCTACGCGCCGCTCACGGCC | intron_variant | Intron 3 of 4 | 1 | ENSP00000413871.1 | ||||
SHH | ENST00000441114.5 | n.302-2592_302-2572dupGCCTACGCGCCGCTCACGGCC | intron_variant | Intron 3 of 4 | 1 | ENSP00000410546.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 35
GnomAD4 exome
Cov.:
35
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not specified Uncertain:1
Oct 05, 2015
Genetic Services Laboratory, University of Chicago
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at