chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_152743.4(BRAT1):​c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC​(p.Glu515SerfsTer15) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

BRAT1
NM_152743.4 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.36

Publications

0 publications found
Variant links:
Genes affected
BRAT1 (HGNC:21701): (BRCA1 associated ATM activator 1) The protein encoded by this ubiquitously expressed gene interacts with the tumor suppressing BRCA1 (breast cancer 1) protein and and the ATM (ataxia telangiectasia mutated) protein. ATM is thought to be a master controller of cell cycle checkpoint signalling pathways that are required for cellular responses to DNA damage such as double-strand breaks that are induced by ionizing radiation and complexes with BRCA1 in the multi-protein complex BASC (BRAC1-associated genome surveillance complex). The protein encoded by this gene is thought to play a role in the DNA damage pathway regulated by BRCA1 and ATM. [provided by RefSeq, Mar 2012]
BRAT1 Gene-Disease associations (from GenCC):
  • neonatal-onset encephalopathy with rigidity and seizures
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, ClinGen, G2P, Labcorp Genetics (formerly Invitae)
  • neurodevelopmental disorder with cerebellar atrophy and with or without seizures
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA is Pathogenic according to our data. Variant chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA is described in ClinVar as Pathogenic. ClinVar VariationId is 540176.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRAT1NM_152743.4 linkc.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC p.Glu515SerfsTer15 frameshift_variant, missense_variant Exon 12 of 14 ENST00000340611.9 NP_689956.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRAT1ENST00000340611.9 linkc.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC p.Glu515SerfsTer15 frameshift_variant, missense_variant Exon 12 of 14 1 NM_152743.4 ENSP00000339637.4

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Neonatal-onset encephalopathy with rigidity and seizures Pathogenic:1
Nov 24, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Glu515Serfs*15) in the BRAT1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRAT1 are known to be pathogenic (PMID: 22279524, 25500575). Information on the frequency of this variant in the gnomAD database is not available, as this variant may be reported differently in the database. This variant has not been reported in the literature in individuals affected with BRAT1-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554293869; hg19: chr7-2579211; API