chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_152743.4(BRAT1):c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC(p.Glu515SerfsTer15) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_152743.4 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- neonatal-onset encephalopathy with rigidity and seizuresInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), G2P
- neurodevelopmental disorder with cerebellar atrophy and with or without seizuresInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_152743.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRAT1 | MANE Select | c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu515SerfsTer15 | frameshift missense | Exon 12 of 14 | NP_689956.2 | Q6PJG6-1 | ||
| BRAT1 | c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu515SerfsTer15 | frameshift missense | Exon 12 of 14 | NP_001337555.1 | ||||
| BRAT1 | c.1018_1039delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu340SerfsTer15 | frameshift missense | Exon 11 of 13 | NP_001337556.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRAT1 | TSL:1 MANE Select | c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu515SerfsTer15 | frameshift missense | Exon 12 of 14 | ENSP00000339637.4 | Q6PJG6-1 | ||
| BRAT1 | c.1780_1801delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu594SerfsTer15 | frameshift missense | Exon 14 of 16 | ENSP00000560522.1 | ||||
| BRAT1 | c.1777_1798delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu593SerfsTer15 | frameshift missense | Exon 14 of 16 | ENSP00000587381.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at