chr7-92504738-CAAGCCGCTGGCTCTGCACCGCATCAGGACTGTGCTCATGTTCCGGGACAGCAGGCAGTCCAGCAATGAGGTCAAGGTCATCCAGCAGGACAACAGATGGCTGCATCCACACTGCCTCTGAGAAAGCCACCTCTAGGGTTTTTTGTATGTTTTCAAGCCT-C
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5
The NM_000466.3(PEX1):c.1906_2064del(p.Arg636_Leu688del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_000466.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- peroxisome biogenesis disorderInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- peroxisome biogenesis disorder 1A (Zellweger)Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health, Ambry Genetics
- Heimler syndrome 1Inheritance: AR Classification: STRONG, MODERATE Submitted by: PanelApp Australia, G2P, Ambry Genetics
- peroxisome biogenesis disorder 1BInheritance: AR Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- Zellweger spectrum disordersInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000466.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PEX1 | NM_000466.3 | MANE Select | c.1906_2064del | p.Arg636_Leu688del | conservative_inframe_deletion | Exon 12 of 24 | NP_000457.1 | ||
| PEX1 | NM_001282678.2 | c.1282_1440del | p.Arg428_Leu480del | conservative_inframe_deletion | Exon 12 of 24 | NP_001269607.1 | |||
| PEX1 | NM_001282677.2 | c.1900+1351_1900+1509del | intron | N/A | NP_001269606.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PEX1 | ENST00000248633.9 | TSL:1 MANE Select | c.1906_2064del | p.Arg636_Leu688del | conservative_inframe_deletion | Exon 12 of 24 | ENSP00000248633.4 | ||
| PEX1 | ENST00000428214.5 | TSL:1 | c.1900+1351_1900+1509del | intron | N/A | ENSP00000394413.1 | |||
| PEX1 | ENST00000951788.1 | c.1906_2064del | p.Arg636_Leu688del | conservative_inframe_deletion | Exon 12 of 24 | ENSP00000621847.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at