chr7-94410286-GGGTGAGCCCGTAAGTAGCTCTATCATCACACTTTTATAAAGTTAATTGTTTTTCTCATTCCAGTTTCTCCAGCTGGACA-G

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_ModeratePP5_Moderate

The NM_000089.4(COL1A2):​c.1081_1090-55delGGTGAGCCCGTAAGTAGCTCTATCATCACACTTTTATAAAGTTAATTGTTTTTCTCATTCCAGTTTCTCCAGCTGGACA​(p.Gly361_Pro363del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

COL1A2
NM_000089.4 splice_donor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 10.0

Publications

0 publications found
Variant links:
Genes affected
COL1A2 (HGNC:2198): (collagen type I alpha 2 chain) This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]
COL1A2 Gene-Disease associations (from GenCC):
  • Ehlers-Danlos syndrome, arthrochalasia type, 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Illumina, PanelApp Australia, Labcorp Genetics (formerly Invitae)
  • osteogenesis imperfecta
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • osteogenesis imperfecta type 1
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • osteogenesis imperfecta type 2
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P, ClinGen
  • osteogenesis imperfecta type 3
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
  • osteogenesis imperfecta type 4
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • Ehlers-Danlos syndrome, arthrochalasia type
    Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
  • Ehlers-Danlos syndrome, cardiac valvular type
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, PanelApp Australia, Orphanet, G2P
  • combined osteogenesis imperfecta and Ehlers-Danlos syndrome 2
    Inheritance: AD Classification: MODERATE Submitted by: ClinGen, Ambry Genetics
  • Ehlers-Danlos/osteogenesis imperfecta syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • high bone mass osteogenesis imperfecta
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.01316752 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
PP5
Variant 7-94410286-GGGTGAGCCCGTAAGTAGCTCTATCATCACACTTTTATAAAGTTAATTGTTTTTCTCATTCCAGTTTCTCCAGCTGGACA-G is Pathogenic according to our data. Variant chr7-94410286-GGGTGAGCCCGTAAGTAGCTCTATCATCACACTTTTATAAAGTTAATTGTTTTTCTCATTCCAGTTTCTCCAGCTGGACA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 447149.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
COL1A2NM_000089.4 linkc.1081_1090-55delGGTGAGCCCGTAAGTAGCTCTATCATCACACTTTTATAAAGTTAATTGTTTTTCTCATTCCAGTTTCTCCAGCTGGACA p.Gly361_Pro363del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 20 of 52 ENST00000297268.11 NP_000080.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
COL1A2ENST00000297268.11 linkc.1081_1090-55delGGTGAGCCCGTAAGTAGCTCTATCATCACACTTTTATAAAGTTAATTGTTTTTCTCATTCCAGTTTCTCCAGCTGGACA p.Gly361_Pro363del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 20 of 52 1 NM_000089.4 ENSP00000297268.6

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Apr 21, 2017
Athena Diagnostics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
10
Mutation Taster
=24/176
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554396162; hg19: chr7-94039598; API