chr7-96121928-G-GCCCGGGCAGCCACCTGTAATCTC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_014251.3(SLC25A13):c.1638_1660dupGAGATTACAGGTGGCTGCCCGGG(p.Ala554GlyfsTer17) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000205 in 1,461,892 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A554A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_014251.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- citrin deficiencyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- citrullinemia, type II, adult-onsetInheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- citrullinemia type IIInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- neonatal intrahepatic cholestasis due to citrin deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SLC25A13 | NM_014251.3 | c.1638_1660dupGAGATTACAGGTGGCTGCCCGGG | p.Ala554GlyfsTer17 | frameshift_variant | Exon 16 of 18 | ENST00000265631.10 | NP_055066.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| SLC25A13 | ENST00000265631.10 | c.1638_1660dupGAGATTACAGGTGGCTGCCCGGG | p.Ala554GlyfsTer17 | frameshift_variant | Exon 16 of 18 | 1 | NM_014251.3 | ENSP00000265631.6 | ||
| SLC25A13 | ENST00000416240.6 | c.1641_1663dupGAGATTACAGGTGGCTGCCCGGG | p.Ala555GlyfsTer17 | frameshift_variant | Exon 16 of 18 | 1 | ENSP00000400101.2 | |||
| SLC25A13 | ENST00000494085.1 | n.48_70dupGAGATTACAGGTGGCTGCCCGGG | non_coding_transcript_exon_variant | Exon 1 of 2 | 2 |
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152098Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000875 AC: 22AN: 251412 AF XY: 0.0000736 show subpopulations
GnomAD4 exome AF: 0.0000205 AC: 30AN: 1461892Hom.: 0 Cov.: 31 AF XY: 0.0000193 AC XY: 14AN XY: 727246 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000197 AC: 3AN: 152216Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74434 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Neonatal intrahepatic cholestasis due to citrin deficiency Pathogenic:3
- -
- -
PVS1+PM3_VS+PP4 -
not provided Pathogenic:3
- -
PM2, PM3_strong, PVS1 -
- -
Citrullinemia type II Pathogenic:2
Variant summary: SLC25A13 c.1638_1660dup23 (p.Ala554GlyfsX17) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic within ClinVar (e.g. c.1799dup [p.Tyr600Ter], c.1813C>T [p.Arg605Ter]). The variant allele was found at a frequency of 8.8e-05 in 251412 control chromosomes (gnomAD), predominantly at a frequency of 0.0012 within the East Asian subpopulation in the gnomAD database. This frequency is not significantly higher than estimated for a pathogenic variant in SLC25A13 causing Citrullinemia Type II (8.8e-05 vs 0.0012), allowing no conclusion about variant significance. c.1638_1660dup23 has been reported in the literature as a biallelic genotype in multiple individuals affected with Citrullinemia (e.g. Song_2011, Wang_2020). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Four ClinVar submitters have assessed the variant since 2014: all four classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
- -
Citrullinemia, type II, adult-onset Pathogenic:1Other:1
- -
- -
Citrin deficiency Pathogenic:1
This sequence change creates a premature translational stop signal (p.Ala554Glyfs*17) in the SLC25A13 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SLC25A13 are known to be pathogenic (PMID: 10369257, 14680984, 27405544). This variant is present in population databases (rs80338725, gnomAD 0.1%). This premature translational stop signal has been observed in individuals with SLC25A13-related conditions (PMID: 27405544). ClinVar contains an entry for this variant (Variation ID: 6003). For these reasons, this variant has been classified as Pathogenic. -
SLC25A13-related disorder Pathogenic:1
The SLC25A13 c.1638_1660dup23 variant is predicted to result in a frameshift and premature protein termination (p.Ala554Glyfs*17). This variant has been reported in numerous pediatric patients with intrahepatic cholestasis with citrin deficiency (Lin WX et al 2016. PubMed ID: 27405544; Nguyen MT et al 2023. PubMed ID: 36599957; Wang NL et al 2019. PubMed ID: 31450232; Song YZ et al 2011. PubMed ID: 21424115) and patients with adult-onset type II citrullinemia (Kobayashi K et al 1999. PubMed ID: 10369257). This variant is almost always reported in a compound heterozygous state with another variant within SLC25A13 (Lin WX et al 2016. PubMed ID: 27405544; Song YZ et al 2011. PubMed ID: 21424115; Wang NL et al 2019. PubMed ID: 31450232), and has been reported in 4 homozygotes as well (Wang NL et al 2019. PubMed ID: 31450232). This variant is reported in 0.12% of alleles in individuals of East Asian descent in gnomAD. Frameshift variants in SLC25A13 are expected to be pathogenic. This variant is interpreted as pathogenic. -
Neonatal intrahepatic cholestasis due to citrin deficiency;CN295299:Citrullinemia, type II, adult-onset Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at