chr8-41694002-CGGTGGAACTTCCGGCGCCGG-C

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000037.4(ANK1):​c.3408_3427delCCGGCGCCGGAAGTTCCACC​(p.Arg1137ProfsTer78) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

ANK1
NM_000037.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.31

Publications

0 publications found
Variant links:
Genes affected
ANK1 (HGNC:492): (ankyrin 1) Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
ANK1 Gene-Disease associations (from GenCC):
  • hereditary spherocytosis
    Inheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
  • hereditary spherocytosis type 1
    Inheritance: AR, AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Laboratory for Molecular Medicine

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 8-41694002-CGGTGGAACTTCCGGCGCCGG-C is Pathogenic according to our data. Variant chr8-41694002-CGGTGGAACTTCCGGCGCCGG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 559408.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ANK1NM_000037.4 linkc.3408_3427delCCGGCGCCGGAAGTTCCACC p.Arg1137ProfsTer78 frameshift_variant Exon 29 of 43 ENST00000289734.13 NP_000028.3 P16157-3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ANK1ENST00000289734.13 linkc.3408_3427delCCGGCGCCGGAAGTTCCACC p.Arg1137ProfsTer78 frameshift_variant Exon 29 of 43 1 NM_000037.4 ENSP00000289734.8 P16157-3

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Apr 10, 2018
MVZ Dr. Eberhard & Partner Dortmund
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554544862; hg19: chr8-41551520; API