chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_152419.3(HGSNAT):c.34_54delCTGCTGGCCGCGTCCGTGCTG(p.Leu12_Leu18del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. L12L) has been classified as Likely benign.
Frequency
Consequence
NM_152419.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- mucopolysaccharidosis type 3Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- mucopolysaccharidosis type 3CInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp, Ambry Genetics, G2P
- retinitis pigmentosa 73Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- retinitis pigmentosaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| HGSNAT | ENST00000379644.9 | c.34_54delCTGCTGGCCGCGTCCGTGCTG | p.Leu12_Leu18del | conservative_inframe_deletion | Exon 1 of 18 | 2 | NM_152419.3 | ENSP00000368965.4 | ||
| HGSNAT | ENST00000520704.1 | n.-117_-97delCTGCTGGCCGCGTCCGTGCTG | non_coding_transcript_exon_variant | Exon 1 of 10 | 1 | ENSP00000429109.1 | ||||
| HGSNAT | ENST00000520704.1 | n.-117_-97delCTGCTGGCCGCGTCCGTGCTG | 5_prime_UTR_variant | Exon 1 of 10 | 1 | ENSP00000429109.1 | ||||
| HGSNAT | ENST00000517319.1 | n.34_54delCTGCTGGCCGCGTCCGTGCTG | non_coding_transcript_exon_variant | Exon 1 of 5 | 4 | ENSP00000430032.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Mucopolysaccharidosis, MPS-III-C Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at