chr8-89943295-TCGAGCATGATGAGCTATTAGATC-T
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_002485.5(NBN):c.2119_2141delGATCTAATAGCTCATCATGCTCG(p.Asp707LysfsTer27) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002485.5 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Microcephaly, normal intelligence and immunodeficiency Pathogenic:1
This variant disrupts the ATM interaction domain of the NBN protein (PMID: 24894818, 21035407), which is important for activating ATM in the double-strand break repair pathway (PMID: 15964794, 15048089). While functional studies have not been performed to directly test the effect of this variant on NBN protein function, this suggests that disruption of this region of the protein is causative of disease. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. ClinVar contains an entry for this variant (Variation ID: 530717). This variant has not been reported in the literature in individuals affected with NBN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asp707Lysfs*27) in the NBN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 48 amino acid(s) of the NBN protein. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at