chr9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001114753.3(ENG):c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG(p.Thr344fs) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T343T) has been classified as Benign. Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 30)
Consequence
ENG
NM_001114753.3 frameshift, missense
NM_001114753.3 frameshift, missense
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 4.21
Genes affected
ENG (HGNC:3349): (endoglin) This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT is Pathogenic according to our data. Variant chr9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT is described in ClinVar as [Pathogenic]. Clinvar id is 407120.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ENG | NM_001114753.3 | c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG | p.Thr344fs | frameshift_variant, missense_variant | 8/15 | ENST00000373203.9 | NP_001108225.1 | |
ENG | NM_000118.4 | c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG | p.Thr344fs | frameshift_variant, missense_variant | 8/14 | NP_000109.1 | ||
ENG | NM_001278138.2 | c.483_514delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG | p.Thr162fs | frameshift_variant, missense_variant | 8/15 | NP_001265067.1 | ||
ENG | NM_001406715.1 | c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG | p.Thr344fs | frameshift_variant, missense_variant | 8/8 | NP_001393644.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 30
GnomAD4 genome
Cov.:
30
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Pathogenic:1
Pathogenic, no assertion criteria provided | provider interpretation | Stanford Center for Inherited Cardiovascular Disease, Stanford University | Oct 14, 2016 | - - |
Hereditary hemorrhagic telangiectasia Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jul 18, 2016 | This sequence change deletes 32 nucleotides and inserts 7 unrelated ones in exon 8 of the ENG mRNA (c.1029_1060delinsATGGTGG ), causing a frameshift at codon 344. This creates a premature translational stop signal (p.Thr344Trpfs*7) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in ENG are known to be pathogenic (PMID: 21158752, 12673790). For these reasons, this variant has been classified as Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at