chr9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001114753.3(ENG):​c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG​(p.Thr344fs) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T343T) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 30)

Consequence

ENG
NM_001114753.3 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 4.21
Variant links:
Genes affected
ENG (HGNC:3349): (endoglin) This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT is Pathogenic according to our data. Variant chr9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT is described in ClinVar as [Pathogenic]. Clinvar id is 407120.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
ENGNM_001114753.3 linkc.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG p.Thr344fs frameshift_variant, missense_variant 8/15 ENST00000373203.9 NP_001108225.1 P17813-1Q96CG0A0A024R878
ENGNM_000118.4 linkc.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG p.Thr344fs frameshift_variant, missense_variant 8/14 NP_000109.1 P17813-2Q5T9B9
ENGNM_001278138.2 linkc.483_514delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG p.Thr162fs frameshift_variant, missense_variant 8/15 NP_001265067.1 P17813Q96CG0F5GX88B7Z6Y5
ENGNM_001406715.1 linkc.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG p.Thr344fs frameshift_variant, missense_variant 8/8 NP_001393644.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
ENGENST00000373203.9 linkc.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG p.Thr344fs frameshift_variant, missense_variant 8/151 NM_001114753.3 ENSP00000362299.4 P17813-1

Frequencies

GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
30

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Pathogenic, no assertion criteria providedprovider interpretationStanford Center for Inherited Cardiovascular Disease, Stanford UniversityOct 14, 2016- -
Hereditary hemorrhagic telangiectasia Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJul 18, 2016This sequence change deletes 32 nucleotides and inserts 7 unrelated ones in exon 8 of the ENG mRNA (c.1029_1060delinsATGGTGG ), causing a frameshift at codon 344. This creates a premature translational stop signal (p.Thr344Trpfs*7) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in ENG are known to be pathogenic (PMID: 21158752, 12673790). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1064792934; hg19: chr9-130586657; API