chr9-133424430-GGCTCACCAGGAGGACACAGAGCGCTATGT-G
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_139027.6(ADAMTS13):c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA(p.Glu98ProfsTer31) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,622 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_139027.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- congenital thrombotic thrombocytopenic purpuraInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ADAMTS13 | NM_139027.6 | c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA | p.Glu98ProfsTer31 | frameshift_variant | Exon 3 of 29 | ENST00000355699.7 | NP_620596.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ADAMTS13 | ENST00000355699.7 | c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA | p.Glu98ProfsTer31 | frameshift_variant | Exon 3 of 29 | 1 | NM_139027.6 | ENSP00000347927.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461622Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 727098 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Upshaw-Schulman syndrome Pathogenic:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at