chr9-133443514-GCCAGCTGTGGCGCTGGAAACCTGCAA-G
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_139027.6(ADAMTS13):c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC(p.Ala793ProfsTer43) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000701 in 1,426,146 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_139027.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- congenital thrombotic thrombocytopenic purpuraInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ADAMTS13 | NM_139027.6 | c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC | p.Ala793ProfsTer43 | frameshift_variant | Exon 19 of 29 | ENST00000355699.7 | NP_620596.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ADAMTS13 | ENST00000355699.7 | c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC | p.Ala793ProfsTer43 | frameshift_variant | Exon 19 of 29 | 1 | NM_139027.6 | ENSP00000347927.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 7.01e-7 AC: 1AN: 1426146Hom.: 0 AF XY: 0.00000141 AC XY: 1AN XY: 707268 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Upshaw-Schulman syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at