chr9-2039776-ACAGCAGCAGCAGCAGCAGCAG-A
Variant summary
Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP6BS1BS2
The NM_003070.5(SMARCA2):c.687_707delGCAGCAGCAGCAGCAGCAGCA(p.Gln230_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000193 in 150,532 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_003070.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -9 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SMARCA2 | NM_003070.5 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | ENST00000349721.8 | NP_003061.3 | |
SMARCA2 | NM_001289396.2 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | NP_001276325.1 | ||
SMARCA2 | NM_139045.4 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_620614.2 | ||
SMARCA2 | NM_001289397.2 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_001276326.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000193 AC: 29AN: 150432Hom.: 0 Cov.: 26
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000289 AC: 418AN: 1445818Hom.: 1 AF XY: 0.000266 AC XY: 191AN XY: 718570
GnomAD4 genome AF: 0.000193 AC: 29AN: 150532Hom.: 0 Cov.: 26 AF XY: 0.000231 AC XY: 17AN XY: 73486
ClinVar
Submissions by phenotype
not provided Uncertain:1Benign:2
SMARCA2: BP3 -
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SMARCA2-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.687_707del, results in the deletion of 7 amino acid(s) of the SMARCA2 protein (p.Gln232_Gln238del), but otherwise preserves the integrity of the reading frame. -
See Variant Classification Assertion Criteria. -
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at