chrX-108595568-CAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA-C
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_033380.3(COL4A5):c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA(p.Pro496LeufsTer50) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_033380.3 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Alport syndromeInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen, G2P
- X-linked Alport syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | NM_033380.3 | MANE Select | c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA | p.Pro496LeufsTer50 | frameshift splice_donor splice_region intron | Exon 22 of 53 | NP_203699.1 | ||
| COL4A5 | NM_000495.5 | c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA | p.Pro496LeufsTer50 | frameshift splice_donor splice_region intron | Exon 22 of 51 | NP_000486.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | ENST00000328300.11 | TSL:1 MANE Select | c.1484_1516+4delAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA | p.Gln495_Gly506delinsArg | splice_donor disruptive_inframe_deletion splice_region intron | Exon 22 of 53 | ENSP00000331902.7 | ||
| COL4A5 | ENST00000483338.1 | TSL:1 | c.308_340+4delAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA | p.Gln103_Gly114delinsArg | splice_donor disruptive_inframe_deletion splice_region intron | Exon 6 of 20 | ENSP00000495685.1 | ||
| COL4A5 | ENST00000361603.7 | TSL:2 | c.1484_1516+4delAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA | p.Gln495_Gly506delinsArg | splice_donor disruptive_inframe_deletion splice_region intron | Exon 22 of 51 | ENSP00000354505.2 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at