chrX-108668367-TTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTC-T
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_033380.3(COL4A5):c.3657_3728delAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCC(p.Gly1220_Pro1243del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_033380.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Alport syndromeInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen, G2P
- X-linked Alport syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | NM_033380.3 | MANE Select | c.3657_3728delAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCC | p.Gly1220_Pro1243del | disruptive_inframe_deletion | Exon 41 of 53 | NP_203699.1 | ||
| COL4A5 | NM_000495.5 | c.3657_3728delAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCC | p.Gly1220_Pro1243del | disruptive_inframe_deletion | Exon 41 of 51 | NP_000486.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | ENST00000328300.11 | TSL:1 MANE Select | c.3657_3728delAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCC | p.Gly1220_Pro1243del | disruptive_inframe_deletion | Exon 41 of 53 | ENSP00000331902.7 | ||
| COL4A5 | ENST00000361603.7 | TSL:2 | c.3657_3728delAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCC | p.Gly1220_Pro1243del | disruptive_inframe_deletion | Exon 41 of 51 | ENSP00000354505.2 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at