chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A

Variant names:

• chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A
• rs267608605
• NM_001110792.2:c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM4 BP6_Moderate

The NM_001110792.2(MECP2):​c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC​(p.Pro401_Pro415del) variant causes a disruptive inframe deletion change. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: not found (cov: 18)
  • Exomes 𝑓: 0.0000011 (0 hom. 0 hem.)
  • Failed GnomAD Quality Control
• Consequence: MECP2 NM_001110792.2 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter U:1 B:1
• Conservation: PhyloP100: 4.53

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.
• BP6: Variant X-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A is Benign according to our data. Variant chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A is described in ClinVar as [Likely_benign]. Clinvar id is 143407.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro401_Pro415del	disruptive_inframe_deletion	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1164_1208delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro389_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro401_Pro415del	disruptive_inframe_deletion	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1164_1208delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro389_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 18

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000111 AC: 1 AN: 900611 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 290651

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000139

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 18

ClinVar

Significance: Likely benign

Submissions summary: Uncertain:1 Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Uncertain:1 Benign:1

Nov 15, 2007

RettBASE

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: curation

- -

Jan 12, 2024

Centre for Population Genomics, CPG

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely benign. At least the following criteria are met: The variant is observed in at least 1 individual with no features of Rett Syndrome (BS2_Supporting). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs267608605; hg19: chrX-153296070;