chrX-154030636-CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGA-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001110792.2(MECP2):c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG(p.Ser387_Glu409del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000000915 in 1,093,222 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S387S) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG | p.Ser387_Glu409del | conservative_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
| MECP2 | NM_004992.4 | c.1123_1191delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG | p.Ser375_Glu397del | conservative_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG | p.Ser387_Glu409del | conservative_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | c.1123_1191delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG | p.Ser375_Glu397del | conservative_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 exome AF: 9.15e-7 AC: 1AN: 1093222Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 360664 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
Rett syndrome Uncertain:2
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: The variant is observed in at least 1 individual with no features of Rett Syndrome (BS2_Supporting)
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at