chrX-18603931-AGTCTCACCACAGATCTAACAGC-A
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001323289.2(CDKL5):c.1008_1029delGTCTCACCACAGATCTAACAGC(p.Ser337ArgfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001323289.2 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CDKL5 | NM_001323289.2 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift_variant | Exon 12 of 18 | ENST00000623535.2 | NP_001310218.1 | |
CDKL5 | NM_001037343.2 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift_variant | Exon 13 of 22 | NP_001032420.1 | ||
CDKL5 | NM_003159.3 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift_variant | Exon 12 of 21 | NP_003150.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Submissions by phenotype
Developmental and epileptic encephalopathy, 2 Pathogenic:1
- -
CDKL5 disorder Pathogenic:1
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant has been identified as a de novo occurrence in an individual with CDKL5 disorder without confirmation of paternity and maternity (PM6). PMID: 23064044 This variant is absent from gnomAD v4 (PM2_Supporting). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at