chrX-18603931-AGTCTCACCACAGATCTAACAGC-A

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_001323289.2(CDKL5):​c.1008_1029delGTCTCACCACAGATCTAACAGC​(p.Ser337ArgfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

CDKL5
NM_001323289.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 7.57

Publications

0 publications found
Variant links:
Genes affected
CDKL5 (HGNC:11411): (cyclin dependent kinase like 5) This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
CDKL5 Gene-Disease associations (from GenCC):
  • CDKL5 disorder
    Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
  • developmental and epileptic encephalopathy, 2
    Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
  • atypical Rett syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • genetic developmental and epileptic encephalopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • infantile spasms
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • precocious puberty
    Inheritance: XL Classification: LIMITED Submitted by: Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant X-18603931-AGTCTCACCACAGATCTAACAGC-A is Pathogenic according to our data. Variant chrX-18603931-AGTCTCACCACAGATCTAACAGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 189551.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CDKL5NM_001323289.2 linkc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337ArgfsTer6 frameshift_variant Exon 12 of 18 ENST00000623535.2 NP_001310218.1 O76039-2
CDKL5NM_001037343.2 linkc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337ArgfsTer6 frameshift_variant Exon 13 of 22 NP_001032420.1 O76039-1
CDKL5NM_003159.3 linkc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337ArgfsTer6 frameshift_variant Exon 12 of 21 NP_003150.1 O76039-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CDKL5ENST00000623535.2 linkc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337ArgfsTer6 frameshift_variant Exon 12 of 18 1 NM_001323289.2 ENSP00000485244.1 O76039-2

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Developmental and epileptic encephalopathy, 2 Pathogenic:1
Mar 13, 2014
RettBASE
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:curation

- -

CDKL5 disorder Pathogenic:1
Sep 18, 2024
Centre for Population Genomics, CPG
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant has been identified as a de novo occurrence in an individual with CDKL5 disorder without confirmation of paternity and maternity (PM6). PMID: 23064044 This variant is absent from gnomAD v4 (PM2_Supporting). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.6
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs786204964; hg19: chrX-18622051; API