chrX-19359553-A-AGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP5
The NM_000284.4(PDHA1):c.1074_1109dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC(p.Ser370_Ser371insProProLeuGluGluLeuGlyTyrHisIleTyrSer) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. S370S) has been classified as Likely benign.
Frequency
Consequence
NM_000284.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Leigh syndromeInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- pyruvate dehydrogenase E1-alpha deficiencyInheritance: XL, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet, G2P, Ambry Genetics
- Leigh syndrome with leukodystrophyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000284.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PDHA1 | NM_000284.4 | MANE Select | c.1074_1109dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC | p.Ser370_Ser371insProProLeuGluGluLeuGlyTyrHisIleTyrSer | disruptive_inframe_insertion | Exon 11 of 11 | NP_000275.1 | ||
| PDHA1 | NM_001173454.2 | c.1188_1223dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC | p.Ser408_Ser409insProProLeuGluGluLeuGlyTyrHisIleTyrSer | disruptive_inframe_insertion | Exon 12 of 12 | NP_001166925.1 | |||
| PDHA1 | NM_001173455.2 | c.1095_1130dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC | p.Ser377_Ser378insProProLeuGluGluLeuGlyTyrHisIleTyrSer | disruptive_inframe_insertion | Exon 11 of 11 | NP_001166926.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PDHA1 | ENST00000422285.7 | TSL:1 MANE Select | c.1074_1109dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC | p.Ser370_Ser371insProProLeuGluGluLeuGlyTyrHisIleTyrSer | disruptive_inframe_insertion | Exon 11 of 11 | ENSP00000394382.2 | ||
| PDHA1 | ENST00000947567.1 | c.1272_1307dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC | p.Ser436_Ser437insProProLeuGluGluLeuGlyTyrHisIleTyrSer | disruptive_inframe_insertion | Exon 13 of 13 | ENSP00000617626.1 | |||
| PDHA1 | ENST00000947577.1 | c.1233_1268dupGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTC | p.Ser423_Ser424insProProLeuGluGluLeuGlyTyrHisIleTyrSer | disruptive_inframe_insertion | Exon 12 of 12 | ENSP00000617636.1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at