chrX-31223122-CTGAAAAGAGGGAAAACAAAGAGCATT-C
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_ModeratePP5_Moderate
The NM_004006.3(DMD):c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA variant causes a splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_004006.3 splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- dilated cardiomyopathy 3BInheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
- Duchenne and Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Duchenne muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- progressive muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- symptomatic form of muscular dystrophy of Duchenne and Becker in female carriersInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004006.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | MANE Select | c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | NP_003997.2 | P11532-1 | |||
| DMD | c.9275-27_9275-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | NP_004000.1 | P11532 | ||||
| DMD | c.9263-27_9263-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | NP_000100.3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | TSL:1 MANE Select | c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | ENSP00000354923.3 | P11532-1 | |||
| DMD | TSL:1 | c.83-27_83-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | ENSP00000367997.3 | P11532-6 | |||
| DMD | TSL:1 | c.83-27_83-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | ENSP00000354464.4 | P11532-5 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at