chrX-32644121-TAAGGACTTACTTGCTTTGTTTTTCCATGCTAGCTACCC-T

Variant names:

• chrX-32644121-TAAGGACTTACTTGCTTTGTTTTTCCATGCTAGCTACCC-T
• rs1556875089
• NM_004006.3:c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_004006.3(DMD):​c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT​(p.Arg435fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: DMD NM_004006.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.29

Genes affected

DMD (HGNC:2928): (dystrophin) This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene. [provided by RefSeq, Dec 2016]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-32644121-TAAGGACTTACTTGCTTTGTTTTTCCATGCTAGCTACCC-T is Pathogenic according to our data. Variant chrX-32644121-TAAGGACTTACTTGCTTTGTTTTTCCATGCTAGCTACCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 447250.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DMD	NM_004006.3	c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT	p.Arg435fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 79	ENST00000357033.9	NP_003997.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DMD	ENST00000357033.9	c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT	p.Arg435fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 79	1	NM_004006.3	ENSP00000354923.3

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Jan 12, 2017

Athena Diagnostics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556875089; hg19: chrX-32662238;