chrX-53250972-GTGCTGGGCAGTCGCTCAGGGGATTGTTGGGGAACTGTGTCATCCAGGTAGAGGGGAAGATCACTGAAGGATGTGGCTGAGCTGTCCTCTTGCTGTTCCTTTGACTCCCGCTTCTCCAGCTGGGCTGACCCTGGCTCCTCAGACATGGGCCCTGACGGGTGGCAGTTCA-G

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3

The NM_001111125.3(IQSEC2):​c.1436_1603del​(p.Leu479_Thr535delinsPro) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 23)

Consequence

IQSEC2
NM_001111125.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 7.58

Publications

0 publications found
Variant links:
Genes affected
IQSEC2 (HGNC:29059): (IQ motif and Sec7 domain ArfGEF 2) This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked cognitive disability. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
IQSEC2 Gene-Disease associations (from GenCC):
  • complex neurodevelopmental disorder
    Inheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
  • intellectual disability, X-linked 1
    Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
  • X-linked complex neurodevelopmental disorder
    Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
  • non-syndromic X-linked intellectual disability
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_001111125.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
IQSEC2NM_001111125.3 linkc.1436_1603del p.Leu479_Thr535delinsPro disruptive_inframe_deletion Exon 5 of 15 ENST00000642864.1 NP_001104595.1 Q5JU85-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
IQSEC2ENST00000642864.1 linkc.1436_1603del p.Leu479_Thr535delinsPro disruptive_inframe_deletion Exon 5 of 15 NM_001111125.3 ENSP00000495726.1 Q5JU85-2

Frequencies

GnomAD3 genomes
Cov.:
23
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
23

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Intellectual disability, X-linked 1 Uncertain:1
Jan 10, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the disrupted amino acids is currently unknown. This variant, c.1436_1603del, results in the deletion of 56 amino acids and inserts 1 amino acid in to the IQSEC2 protein (p.Leu479_Thr535delinsPro), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with IQSEC2-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1556863457; hg19: chrX-53280154; API