rs104886412

Variant names:

• chrX-108687488-GTGGTTTGGATGGTCCCCCTGGTCCAGA-G
• rs104886412
• NM_033380.3:c.4326_4352delTTTGGATGGTCCCCCTGGTCCAGATGG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_033380.3(COL4A5):​c.4326_4352delTTTGGATGGTCCCCCTGGTCCAGATGG​(p.Leu1443_Gly1451del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 22)
• Consequence: COL4A5 NM_033380.3 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 9.45
• Publications: 1 publications found

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

COL4A5 Gene-Disease associations (from GenCC):

• Alport syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen, G2P
• X-linked Alport syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 3 benign, 2 uncertain in NM_033380.3
• PM4: Nonframeshift variant in NON repetitive region in NM_033380.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL4A5	NM_033380.3	c.4326_4352delTTTGGATGGTCCCCCTGGTCCAGATGG	p.Leu1443_Gly1451del	disruptive_inframe_deletion	Exon 49 of 53	ENST00000328300.11	NP_203699.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL4A5	ENST00000328300.11	c.4326_4352delTTTGGATGGTCCCCCTGGTCCAGATGG	p.Leu1443_Gly1451del	disruptive_inframe_deletion	Exon 49 of 53	1	NM_033380.3	ENSP00000331902.7

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104886412; hg19: chrX-107930718;