rs104895272

Variant names:

• chr12-6330865-TGCCCTTAACATTCTCAATCTGGGGTAG-T
• rs104895272
• NM_001065.4:c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001065.4(TNFRSF1A):​c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC​(p.Leu196_Gly204del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TNFRSF1A NM_001065.4 conservative_inframe_deletion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.998
• Publications: 3 publications found

Genes affected

TNFRSF1A (HGNC:11916): (TNF receptor superfamily member 1A) This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mutations in this gene underlie tumor necrosis factor receptor-associated periodic syndrome (TRAPS), characterized by fever, abdominal pain and other features. Mutations in this gene may also be associated with multiple sclerosis in human patients. [provided by RefSeq, Sep 2016]

TNFRSF1A Gene-Disease associations (from GenCC):

• TNF receptor 1-associated periodic fever syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Laboratory for Molecular Medicine, Illumina

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001065.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TNFRSF1A	NM_001065.4	c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC	p.Leu196_Gly204del	conservative_inframe_deletion	Exon 6 of 10	ENST00000162749.7	NP_001056.1
TNFRSF1A	NM_001346091.2	c.262_288delCTACCCCAGATTGAGAATGTTAAGGGC	p.Leu88_Gly96del	conservative_inframe_deletion	Exon 5 of 9		NP_001333020.1
TNFRSF1A	NM_001346092.2	c.127_153delCTACCCCAGATTGAGAATGTTAAGGGC	p.Leu43_Gly51del	conservative_inframe_deletion	Exon 7 of 11		NP_001333021.1
TNFRSF1A	NR_144351.2	n.814-181_814-155delCTACCCCAGATTGAGAATGTTAAGGGC		intron_variant	Intron 5 of 8

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TNFRSF1A	ENST00000162749.7	c.586_612delCTACCCCAGATTGAGAATGTTAAGGGC	p.Leu196_Gly204del	conservative_inframe_deletion	Exon 6 of 10	1	NM_001065.4	ENSP00000162749.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

TNF receptor-associated periodic fever syndrome (TRAPS) Other:1

-

Unité médicale des maladies autoinflammatoires, CHRU Montpellier

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.0
Mutation Taster		=33/167	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104895272; hg19: chr12-6440031;