rs1057519844

Variant names:

• chr5-112839521-AAAGATTGGAACTAGGTCAGC-A
• rs1057519844
• NM_000038.6:c.3928_3947delAAGATTGGAACTAGGTCAGC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000038.6(APC):​c.3928_3947delAAGATTGGAACTAGGTCAGC​(p.Lys1310fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. K1310K) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: APC NM_000038.6 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.01
• Publications: 0 publications found

Genes affected

APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

APC Gene-Disease associations (from GenCC):

• classic or attenuated familial adenomatous polyposis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• desmoid tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• familial adenomatous polyposis 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• gastric adenocarcinoma and proximal polyposis of the stomach

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• APC-related attenuated familial adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Turcot syndrome with polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cenani-Lenz syndactyly syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000258864 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 818 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000038.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	APC	NM_000038.6	MANE Select	c.3928_3947delAAGATTGGAACTAGGTCAGC	p.Lys1310fs	frameshift	Exon 16 of 16	NP_000029.2
	APC	NM_001407446.1		c.4012_4031delAAGATTGGAACTAGGTCAGC	p.Lys1338fs	frameshift	Exon 16 of 16	NP_001394375.1
	APC	NM_001354896.2		c.3982_4001delAAGATTGGAACTAGGTCAGC	p.Lys1328fs	frameshift	Exon 17 of 17	NP_001341825.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	APC	ENST00000257430.9	TSL:5 MANE Select	c.3928_3947delAAGATTGGAACTAGGTCAGC	p.Lys1310fs	frameshift	Exon 16 of 16	ENSP00000257430.4
	APC	ENST00000508376.6	TSL:1	c.3928_3947delAAGATTGGAACTAGGTCAGC	p.Lys1310fs	frameshift	Exon 17 of 17	ENSP00000427089.2
	APC	ENST00000502371.3	TSL:1	n.*2126_*2145delAAGATTGGAACTAGGTCAGC		non_coding_transcript_exon	Exon 12 of 12	ENSP00000484935.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1057519844; hg19: chr5-112175218;