rs118203560

Variant names:

• chr9-132905872-T-TCTCCCGCAGGGCTTTCATCAGCA
• rs118203560
• NM_000368.5:c.1683_1705dupTGCTGATGAAAGCCCTGCGGGAG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000368.5(TSC1):​c.1683_1705dupTGCTGATGAAAGCCCTGCGGGAG​(p.Asp569ValfsTer68) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Synonymous variant affecting the same amino acid position (i.e. D569D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC1 NM_000368.5 frameshift
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.118
• Publications: 0 publications found

Genes affected

TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC1 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
• lung lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC1	NM_000368.5	c.1683_1705dupTGCTGATGAAAGCCCTGCGGGAG	p.Asp569ValfsTer68	frameshift_variant	Exon 15 of 23	ENST00000298552.9	NP_000359.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC1	ENST00000298552.9	c.1683_1705dupTGCTGATGAAAGCCCTGCGGGAG	p.Asp569ValfsTer68	frameshift_variant	Exon 15 of 23	1	NM_000368.5	ENSP00000298552.3
TSC1	ENST00000490179.4	c.1683_1705dupTGCTGATGAAAGCCCTGCGGGAG	p.Asp569ValfsTer68	frameshift_variant	Exon 16 of 24	3		ENSP00000495533.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Tuberous sclerosis syndrome Other:1

-

Tuberous sclerosis database (TSC1)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.12

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs118203560; hg19: chr9-135781259;