rs118203674
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000368.5(TSC1):c.2298_2320delGCAGCGTGACACTATGGTAACCA(p.Gln767AlafsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Synonymous variant affecting the same amino acid position (i.e. E766E) has been classified as Benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000368.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Genomics England PanelApp
- lung lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000368.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC1 | MANE Select | c.2298_2320delGCAGCGTGACACTATGGTAACCA | p.Gln767AlafsTer11 | frameshift | Exon 18 of 23 | NP_000359.1 | Q92574-1 | ||
| TSC1 | c.2298_2320delGCAGCGTGACACTATGGTAACCA | p.Gln767AlafsTer11 | frameshift | Exon 18 of 23 | NP_001393521.1 | X5D9D2 | |||
| TSC1 | c.2298_2320delGCAGCGTGACACTATGGTAACCA | p.Gln767AlafsTer11 | frameshift | Exon 18 of 23 | NP_001393522.1 | Q92574-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC1 | TSL:1 MANE Select | c.2298_2320delGCAGCGTGACACTATGGTAACCA | p.Gln767AlafsTer11 | frameshift | Exon 18 of 23 | ENSP00000298552.3 | Q92574-1 | ||
| TSC1 | TSL:3 | c.2298_2320delGCAGCGTGACACTATGGTAACCA | p.Gln767AlafsTer11 | frameshift | Exon 19 of 24 | ENSP00000495533.2 | Q92574-1 | ||
| TSC1 | c.2298_2320delGCAGCGTGACACTATGGTAACCA | p.Gln767AlafsTer11 | frameshift | Exon 18 of 23 | ENSP00000495158.1 | Q92574-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.