rs1272503308

Variant names:

• chr12-132677604-GGCGGATGTGGTAGGGAACATCGTACTC-G
• rs1272503308
• NM_006231.4:c.667_693delGAGTACGATGTTCCCTACCACATCCGC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_006231.4(POLE):​c.667_693delGAGTACGATGTTCCCTACCACATCCGC​(p.Glu223_Arg231del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,892 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. E223E) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: POLE NM_006231.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006231.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLE	NM_006231.4	c.667_693delGAGTACGATGTTCCCTACCACATCCGC	p.Glu223_Arg231del	conservative_inframe_deletion	Exon 7 of 49	ENST00000320574.10	NP_006222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLE	ENST00000320574.10	c.667_693delGAGTACGATGTTCCCTACCACATCCGC	p.Glu223_Arg231del	conservative_inframe_deletion	Exon 7 of 49	1	NM_006231.4	ENSP00000322570.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251424 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461892 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727246

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1112010

Other (OTH) AF: 0.00 AC: 0 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000203), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:1

Dec 26, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.667_693del, results in the deletion of 9 amino acid(s) of the POLE protein (p.Glu223_Arg231del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 540624). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Jan 15, 2025

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.667_693del27 variant (also known as p.E223_R231del) is located in coding exon 7 of the POLE gene. This variant results from an in-frame GAGTACGATGTTCCCTACCACATCCGC deletion at nucleotide positions 667 to 693. This results in the in-frame deletion of a 9 amino acids (EYDVPYHIR) at codons 223 to 231. This amino acid region is well conserved in available vertebrate species. Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1272503308; hg19: chr12-133254190;