rs1272503308
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3
The NM_006231.4(POLE):c.667_693delGAGTACGATGTTCCCTACCACATCCGC(p.Glu223_Arg231del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,892 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_006231.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 5 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.00000398 AC: 1AN: 251424Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 135888
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461892Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727246
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.667_693del, results in the deletion of 9 amino acid(s) of the POLE protein (p.Glu223_Arg231del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 540624). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.667_693del27 variant (also known as p.E223_R231del) is located in coding exon 7 of the POLE gene. This variant results from an in-frame GAGTACGATGTTCCCTACCACATCCGC deletion at nucleotide positions 667 to 693. This results in the in-frame deletion of a 9 amino acids (EYDVPYHIR) at codons 223 to 231. This amino acid region is well conserved in available vertebrate species. Based on the available evidence, the clinical significance of this variant remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at