Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1PM4PP3PP5_Moderate
The NM_000548.5(TSC2):c.1220_1240delACTTTGAACTGGTGGAGAGAT(p.Tyr407_Arg413del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Y407Y) has been classified as Likely benign.
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
TSC2 Gene-Disease associations (from GenCC):
tuberous sclerosis
Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
tuberous sclerosis 2
Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
lymphangioleiomyomatosis
Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
tuberous sclerosis complex
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Our verdict: Likely_pathogenic. The variant received 7 ACMG points.
PM1
In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 6 benign, 28 uncertain in NM_000548.5
PM4
Nonframeshift variant in NON repetitive region in NM_000548.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 16-2061962-AGGAGAGATACTTTGAACTGGT-A is Pathogenic according to our data. Variant chr16-2061962-AGGAGAGATACTTTGAACTGGT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 49145.Status of the report is criteria_provided_single_submitter, 1 stars.