rs137854159

Variant names:

• chr16-2065516-AAGGTGATGGCCCGCTCCCTCTCCCCACCCCCGGAGCTGGAAGAAAGGGATGTGGCCGCATACTCGGCCTCCTTGGAGGATGTGAAGACAGCCGTCCTGGGGCTTCTGGTCATCCTTC-A
• rs137854159
• ENST00000219476.9:c.1600_1716del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000548.5(TSC2):​c.1603_1716+3del​(p.Met535_Gln572del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC2 NM_000548.5 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 7.97
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.021570796 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	NM_000548.5	MANE Select	c.1603_1716+3del	p.Met535_Gln572del	splice_donor conservative_inframe_deletion splice_region intron	Exon 16 of 42	NP_000539.2	P49815-1
	TSC2	NM_001406663.1		c.1603_1716+3del	p.Met535_Gln572del	splice_donor conservative_inframe_deletion splice_region intron	Exon 16 of 42	NP_001393592.1	A0A2R8Y6C9
	TSC2	NM_001114382.3		c.1603_1716+3del	p.Met535_Gln572del	splice_donor conservative_inframe_deletion splice_region intron	Exon 16 of 41	NP_001107854.1	P49815-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	ENST00000219476.9	TSL:5 MANE Select	c.1600_1716del		exon_loss splice_region	Exon 16 of 42	ENSP00000219476.3	P49815-1
	TSC2	ENST00000350773.9	TSL:1	c.1600_1716del		exon_loss splice_region	Exon 16 of 41	ENSP00000344383.4	P49815-4
	TSC2	ENST00000401874.7	TSL:1	c.1600_1716del		exon_loss splice_region	Exon 16 of 40	ENSP00000384468.2	P49815-5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs137854159; hg19: chr16-2115517;