rs1553618323

Variant names:

• chr3-9435881-CAGCACCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGG-C
• rs1553618323
• NM_001080517.3:c.547_567+60delCCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGGAGCA

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001080517.3(SETD5):​c.547_567+60delCCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGGAGCA​(p.Pro183_Lys189del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SETD5 NM_001080517.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.78
• Publications: 0 publications found

Genes affected

SETD5 (HGNC:25566): (SET domain containing 5) This function of this gene has yet to be determined but based on sequence similarity to other SET domain proteins it may function as a histone methyltransferase. Mutations in this gene have been associated with an autosomal dominant form of intellectual disability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2017]

SETD5 Gene-Disease associations (from GenCC):

• intellectual disability-facial dysmorphism syndrome due to SETD5 haploinsufficiency

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae)
• syndromic complex neurodevelopmental disorder

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 3-9435881-CAGCACCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGG-C is Pathogenic according to our data. Variant chr3-9435881-CAGCACCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 219199.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001080517.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SETD5	NM_001080517.3	MANE Select	c.547_567+60delCCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGGAGCA	p.Pro183_Lys189del	splice_donor conservative_inframe_deletion splice_region intron	Exon 7 of 23	NP_001073986.1
	SETD5	NM_001437635.1		c.604_624+60delCCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGGAGCA	p.Pro202_Lys208del	splice_donor conservative_inframe_deletion splice_region intron	Exon 7 of 24	NP_001424564.1
	SETD5	NM_001437633.1		c.604_624+60delCCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGGAGCA	p.Pro202_Lys208del	splice_donor conservative_inframe_deletion splice_region intron	Exon 7 of 24	NP_001424562.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SETD5	ENST00000402198.7	TSL:5 MANE Select	c.543_567+56delAGCACCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGG	p.Ala182ArgfsTer1235	frameshift splice_donor splice_region intron	Exon 7 of 23	ENSP00000385852.2
	SETD5	ENST00000493918.5	TSL:1	n.707_731+56delAGCACCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGG		splice_donor splice_region intron non_coding_transcript_exon	Exon 3 of 19
	SETD5	ENST00000682536.1		c.600_624+56delAGCACCAAAGACGAAGAAAATCAAGGTATGCAGGGTAAAAATATCTTAAATAGAAATTGTCTGAAATAGCTTAAATTTTGG	p.Ala201GlnfsTer1248	frameshift splice_donor splice_region intron	Exon 7 of 24	ENSP00000507956.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Intellectual disability-facial dysmorphism syndrome due to SETD5 haploinsufficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553618323; hg19: chr3-9477565;